The Human
|
||||||||||||||
|
SECTION 1
Introduction SECTION 2 SECTION 3 HGP SECTION 4
|
 Obviously much can be learned from our DNA sequences. In October 1990, the Human Genome Project officially began. It was an international attempt to map and sequence the entire human genome. In other words, scientists wanted to determine where each gene was located in relation to other genes on the same chromosome. The result was the sequencing (discovering the order of G’s, C’s, T’s, and A’s) of all 23 pairs of human chromosomes. Technologies were also developed that made sequencing faster, easier, and cheaper. To sequence the DNA a scientist must 1.
Isolate the DNA segment that is to be studied. tgacttacctgtgttagaagattgtgtactggctagtacgtacaaggtactatc
actgaatggacacaatcttctaacacatgaccgatcatgcatgttccatgatag Shred the DNA into smaller pieces, making lots of DNA fragments.
2.
Since billions of copies of each DNA fragment are required for efficient
analysis, scientists insert the human DNA fragments into bacteria.
If given the right nutrients, the bacteria will make billions of copies
of themselves- and the human DNA fragments- overnight. 3.
The human DNA is extracted and the double helix of the DNA is separated
in single strands.
4. The single DNA strand is mixed with the four nucleotides needed to construct complimentary strands. These nucleotides are also fluorescent-each type of bases is in a different color. tgacttacctgtgt actgaatggacaca
The
DNA fragments are placed inside a sequencing machine. The negatively
charged DNA fragment is pulled toward a positive charge at the end of each
tube when an electric current is run through the DNA. As DNA
fragments reach the positive end, a laser beam excites the fluorescent
dyes, and a camera records the colors. The sequence of colors
indicates the order of the nucleotides in the complimentary strands.
As a result, a portion of the sequence has been captured. _____________
A
_____________ C _____________
T _____________
G _____________
A _____________
A _____________
T _____________
G _____________
G _____________
A _____________
C _____________
A _____________
C _____________
A completion of the human place among the other gift. With the completion of the human genome sequence, we “Humanity has been given we have received a powerful tool for other participants in the adventure of life.” finding our place heritage and for finding our place given a great gift. With powerful tool for unlocking the secrets of our genetic heritage The computer would do essentially the same thing your brain did, but with DNA. The resulting printout will be a graph. Let’s give it a shot! (If
you want to learn more, PBS has a program called
"Sequence
Yourself" that can be accessed online.) |
